Hande, Shailaja and Jayabaskaran, Chelliah (1997) Nucleotide sequence of a cucumber chloroplast proline tRNA. In: Journal of Bioscience, 22 (2). pp. 143-147.
|
PDF
5.pdf - Published Version Download (135kB) |
Official URL: http://www.ias.ac.in/j_archive/jbiosci/22/2/march(...
Abstract
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Item Type: | Journal Article |
---|---|
Publication: | Journal of Bioscience |
Publisher: | Indian academy of sciences |
Additional Information: | Copyrght for this article belongs to Indian academy of sciences. |
Keywords: | Nucleotide sequence; Cucumber chloroplast; Proline tRNA |
Department/Centre: | Division of Biological Sciences > Biochemistry |
Date Deposited: | 13 Jan 2010 12:01 |
Last Modified: | 19 Sep 2010 05:51 |
URI: | http://eprints.iisc.ac.in/id/eprint/24657 |
Actions (login required)
View Item |