Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

Pal, Subrata and Maiti, Prabal K and Bagchi, Biman (2005) Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO. In: Journal of Physics: Condensed Matter, 17 (49). S4317-S4331.

PDF Anisotropic.pdf Restricted to Registered users only Download (426kB) | Request a copy

Abstract

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is subdiffusive, with mean square displacement (MSD) growing as $t^{\alpha}$ with $\alpha \simeq 0.43$. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859–73). We compare these results with dynamics of watermolecules at the surface of an anionicmicelle, cesiumperfluorooctanoate(CsPFO). Watermolecules on the surface ofCsPFOalso exhibit slowtranslation and non-exponential orientational dynamics.

Item Type:	Journal Article
Publication:	Journal of Physics: Condensed Matter
Publisher:	IOP Publishing Ltd
Additional Information:	The Copyright belongs to IOP Publishing Ltd.
Department/Centre:	Division of Chemical Sciences > Solid State & Structural Chemistry Unit Division of Physical & Mathematical Sciences > Physics
Date Deposited:	03 Apr 2006
Last Modified:	19 Sep 2010 04:25
URI:	http://eprints.iisc.ac.in/id/eprint/6159

Actions (login required)

View Item