ePrints@IIScePrints@IISc Home | About | Browse | Latest Additions | Advanced Search | Contact | Help

Nucleotide sequence of a cucumber chloroplast proline tRNA

Hande, Shailaja and Jayabaskaran, Chelliah (1997) Nucleotide sequence of a cucumber chloroplast proline tRNA. In: Journal of Bioscience, 22 (2). pp. 143-147.

[img]
Preview
PDF
5.pdf - Published Version

Download (135kB)
Official URL: http://www.ias.ac.in/j_archive/jbiosci/22/2/march(...

Abstract

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Item Type: Journal Article
Additional Information: Copyrght for this article belongs to Indian academy of sciences.
Keywords: Nucleotide sequence; Cucumber chloroplast; Proline tRNA
Department/Centre: Division of Biological Sciences > Biochemistry
Depositing User: Mr. Khaleel Ahmed Haveri
Date Deposited: 13 Jan 2010 12:01
Last Modified: 19 Sep 2010 05:51
URI: http://eprints.iisc.ac.in/id/eprint/24657

Actions (login required)

View Item View Item